Egg
“pathetic”
“Then perish”
(via rockboci)
[video]
[video]
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is “too short” and “doesn’t match any known organism” and if my genome looked like that i would be “dead” but maybe those people simply haven’t optimized their genomes like I have
(via rockboci)
Not to sound like some sorta furry sympathizer but my life would be at least 30% better if i had giant ram horns growing outta my scalp. top heavy as hell, gettig stuck in doorways n shit. Thats the life
You know you’re in trouble when you’re playing an RPG with a generically medieval setting and suddenly there’s a dungeon with an EDM soundtrack.
@tasersandkittens replied:
invert it. make a mideval fantasy game with all modern music genres for the soundtrack, except the ancient space ruins have hurdy gurdies and shit.
Only if the gurdy gurdy in question is this one:
(Wait for it.)
(via stemmmm)
abab
assigned born at birth
assigned baby at birth
all babies are bastards
all babies are birthed
(via newbarrk)
why is this so true
As someone who’s tagged images for an AI neural network, you want to ignore those. just throwing that out there so yall don’t gotta worry too hard bout it
Thats just what an AI would say
(via newbarrk)
(via newbarrk)
grimxask12 asked:
Has mew or Huey tried lemons yet.
cross anything sour off the list of food he likes