[video]
(via wuffleton)
Villain Deku AU except instead of stabbing people he’s a 911 operator
(via moonpaw)
[video]
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
(via tamascotchi-deactivated20190101)
conservative parents: this video game gives you the option to have a tail and you need to remove that this instant before my son becomes a devil worshipping homosexual. this coffee cup sold in the winter doesn’t have “thank the lord jesus” engraved into it so i am boycotting beverages.
conservative young adults: lul liberal sjw cucks triggered over my teenage girl body pillow
(via tamascotchi-deactivated20190101)
[video]
*The Birth of Modern Oligarchy
dont fucking forget what happened in 1980… fucking reagan and reaganonics. this is why republicans still celebrate that shitty old bitch
(via wuffleton)
TAZ: Amnesty characters as Matt Adrian’s Troubled Birds
The whole Pine Guard:
[ID: an image from the Guide to Troubled Birds: “That’s a crazy idea. Insane. It doesn’t make sense. ‘You’ll do it?’ ‘Of course,’ I replied.” End id]
Duck:
[ID: an image from the Guide to Troubled Birds: “Finally he gathered himself together and spoke. ‘What the hell?’” End id]
Aubrey:
[ID: an image from the Guide to Troubled Birds: “The risk I took was calculated, but man, am I bad at math.” End id]
Ned:
[ID: an image from the Guide to Troubled Birds: “I’ve never been one to half-ass shenanigans.” End id]
Mama:
[ID: an image from the Guide to Troubled Birds: “Dealing with you is like herding cats.” End id]
Barclay:
[ID: an image from the Guide to Troubled Birds: “The ability to remain sober and gracious is, indeed, a form of mild insanity.” End id]
Beacon:
[ID: an image from the Guide to Troubled Birds: “I disembowel. It’s what I do.” End id]
Minerva:
[ID: an image from the Guide to Troubled Birds: “Things just got super weird - it’s my time to shine.” End id]
Indrid:
[ID: an image from the Guide to Troubled Birds: “He gave them the heebie-jeebies. He had nothing else to give. End id]
Jake Coolice:
[ID: an image from the Guide to Troubled Birds: “I am often seized by the fatal American need to have a pretty good time.” End id]
(via officialspec2)
Avatar: The Last Airbender 1.05 | The King of Omashu
Wow those moves look like someone who’s childhood best friend was an airbender
…Shit, you’re right.
That spin he does. That is an airbendery move.
boomy is one of the greatest characters
(via afallenwolf)
