The way they don’t process how the immediate influx of cash can, if used right, lead to getting the book, or having the credit score, or even having an actual meeting with a celebrity (since he’s also a businessman) is always gonna stab my brain the wrong way
Capitalism is a hell of a drug.
You’re not “built different” because you think “hustling” for every measley little dollar is better than having a life where you can actually do what you want without fear of starvation, you’ve been brainwashed.
Exclusionists are fucking laughable tbh. Imagine making hatred a core facet of your fucking identity, what a joke. You must be a riot at parties.
“But they’re taking up all of the LGBT resources!!!” lmao what the fuck is this? Age of Empires? Fucking ARK? I WANT TO BUILD AN AUTO TURRET BUT THE ASEXUALS HAVE BUILT PILLARS OVER ALL THE METAL SPAWNS :((((((
reblog if youre an ace who built pillars over the metal spawns
no offence but i think a lot of us me included don’t actually want romantic love as badly as we think and really are just lonely and crave a closeness and intimacy that feels out of reach in friendships because of society’s emphasis on marriage and the nuclear family so we project that into the never ending search for a perfect love and a soulmate when really we all just want to mean something to someone
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is “too short” and “doesn’t match any known organism” and if my genome looked like that i would be “dead” but maybe those people simply haven’t optimized their genomes like I have