How the fuck does Akko just casually see this bird, an albino crow with a fucking star on his chest’ and not think “Wow this bird looks a lot like Shiny Chariot’s signature familiar, Alcor” like what the fuck Akko.
She has a plush of this very bird. This girl has probably memorized the trading card he’s on and could recite it by heart. She probably knows every fact there is to know about him, and here she is going “Oh wow what a nice bird”
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is “too short” and “doesn’t match any known organism” and if my genome looked like that i would be “dead” but maybe those people simply haven’t optimized their genomes like I have
Not to sound like some sorta furry sympathizer but my life would be at least 30% better if i had giant ram horns growing outta my scalp. top heavy as hell, gettig stuck in doorways n shit. Thats the life
As someone who’s tagged images for an AI neural network, you want to ignore those. just throwing that out there so yall don’t gotta worry too hard bout it
I am Silver Tongue, I am an artist. I have many characters and you can check out my art in the art tag. I occasionally practice witchcraft though I don't do anything too complicated. I am girl 2 and don't know what else to put here.
