people slipping up and saying shit like “biological name” instead of “deadname” is more or less proof these people don’t actually care about real science they just want smart sounding words and i guarantee if we could manipulate chromosomes they’d abandon all pretext of science and start yammering about how people are born with a “masculine/feminine essence” that “cant be changed” like none of these people actually know the chromosomes real fuckin function and they dont care they just know they cant be changed
“Biological name”
Scientists scanned my dna, I’m genetically a Sally but I chose my own fate.
i changed my name for non gender related reasons and people like to ask me “what’s your birth name” and i say “oh i actually wasn’t born with a name my parents just gave me one” and that tends to shut people up
My biological name? Oh it’s GATTCTCAGCGCGATCGTAGCTAGCGCGCTATCGATCGATAGCTAG
if my blog gets deleted you can find me in
a cave located beside Pacifidlog Town in the Route 134 ocean current. Take note that you will have to stick towards the very bottom of the screen. It is in a space of calm water there with a dark spot to Dive. Go where the inscription is and press B; say yes and go to the end. Use Dig go to the end of that tunnel and read the inscription. Put Relicanth last in your party and Wailord first, then go back and read the inscription again and there will be an earthquake. If this doesn’t work go and switch Relicanth to first and Wailord to last and there should be an earthquake. Then a box tells you it sounds like doors opening far away.
if my blog gets deleted, find me on the island on Route 130 when the last two bytes of the personality value of one of your party members matches matches a random value shuffled daily between 0x0000 and 0xFFFF
find me on select water tiles on route 119, but be careful of altering random values between attempts lest I change position
You can find me by holding the DS upside down while I level up
I do not own these pics. They were sent to me in an email. But I thought I’d share with you all because they’re just AMAZING.
DRAGONS
I feel so stupid I didn’t know they could fly, I thought they were like CHICKENS, I never questioned it because these pictures never circulate, I am WAY OVER MY HEAD.
My mom is a serious birder. One time she saw a peacock flying, and she swore that it was a phoenix
you know, seeing a peacock in flight makes me think that maybe the original depictins of angels where they have many wings, many eyes and are on fire were actually just peacocks all along
hot take: the problem isnt the manic pixie dream girl. its the boring ass moody emotional leech guy she always gets paired with. we need more manic pixie dream characters. just give them partners who are as great as them or let them be happy alone! no more smart, beautiful, optimistic, kind girls getting paired with actual mosquitoes of men!
Also: make some manic pixie dream boys. If I wanna see romance maybe I wanna see a giddy boy full of positive energy who tells you fun facts about the constellations. Stop teaching boys they have to be moody and sad and they have to find salvation in a dream girl, this is how you breed Bad Men.
Me trying to explain to someone that doesn’t have Visual Snow about the static that covers everything I see.
Here’s a gif to demonstrate.
Imagine that, overlayed over your entire field of vision. Even when your eyes are closed. (especially when your eyes are closed.)
*looks up from computer* now wait just one minute
This is a real thing that exists, not intrusive thought. This is the reason I have glasses. I was a little kid, thought it was normal, tried to point them out to my mom, and she freaked out and brought me to an eye doctor. Where we found out I have shit eyesight. And also apparently where she learned what visual snow was.
But. She deicded. Not. To tell me.
(Like she’s also decided not to tell me or my twin that we’re autistic)
So it literally took me more than a decade to find a word for this.
Which is why I made this post.
She mentioned casually last year to her boyfriend that she learned I had visual snow when I was little and I’m jyst sitting there, having already painstakingly figured all of this out on my own like, “and you didn’t think that was worth explaining to me even when I brought it to your atfention?????”
So ueah.
It’s a thing. If you see staticy moving dots everywhere even with your eyes closed, you’ve got Visual Snow.
I am Silver Tongue, I am an artist. I have many characters and you can check out my art in the art tag. I occasionally practice witchcraft though I don't do anything too complicated. I am girl 2 and don't know what else to put here.
