intranet:

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

prehistories:

me: waking up from top surgery

doctor: here are your male presenting nipples sir

krinkshame:

*posts any picture*

tumblr:

image

officialspec2:

yall remember when the biggest problem with this sites coding was the video player

I miss the days when the worst thing you had to worry about was that colour of the sky post popping up on your dash

pietriarchy:

from now on the system is gonna skip from 68 notes straight to 70 just to be safe

chandra-nalaar:

i just went on r/incels to see if it was really that bad and it was actually pretty informative. i found out that women are all powerful beings and we control society by exploiting men for their money and their jobs, are NOT required to pay bills, and that we all make 50k a month on patreon. like shit why did no one tell me. i didnt even know i had a patreon

not-natural-moose-and-squirrel:

jheselbraum:

Like. I’m a firm believer that porn online shouldn’t be within kids reach (those “are you 18” checkboxes for life) but. Like. Ok first of all, just ban cp? It’s not hard? Cp is what got you into this mess just ban it. Second of all, you could increase the age of sign-up from 13 to 18. Third of all, you could do what deviantart does and just. Require birthdays at sign-up. If your blog is flagged as nsfw, you can’t interact with minors. You want to follow an nsfw blog? Prove you’re an adult. You’re an adult but don’t want to see nsfw content? Safe search (that actually works).

It’s not hard to make a functioning website, but staff doesn’t seem to want to do that.

@staff @staff @staff @staff @staff

aggressivewastebin:

what bastard takes their minecraft dogs mining or hunting? those bitches stay inside safe from harm sitting down

jvlianbashir:

when you find an academic source that’s perfect for your paper but it’s behind a pay wall

image