I also want to make it abundantly clear this is why people say “fuck cops” and why “Blue Lives Matter” is bullshit. It may only be a “handful” of corrupt cops (which is also bullshit) but it’s the entire institution behind them that enables them and refuses to take any form of accountability. Every single cop is complicit. Every single one.
“It’s only a few bad apples” they say as the apparent good apples rush to protect hypothetical bad ones
people slipping up and saying shit like “biological name” instead of “deadname” is more or less proof these people don’t actually care about real science they just want smart sounding words and i guarantee if we could manipulate chromosomes they’d abandon all pretext of science and start yammering about how people are born with a “masculine/feminine essence” that “cant be changed” like none of these people actually know the chromosomes real fuckin function and they dont care they just know they cant be changed
“Biological name”
Scientists scanned my dna, I’m genetically a Sally but I chose my own fate.
i changed my name for non gender related reasons and people like to ask me “what’s your birth name” and i say “oh i actually wasn’t born with a name my parents just gave me one” and that tends to shut people up
My biological name? Oh it’s GATTCTCAGCGCGATCGTAGCTAGCGCGCTATCGATCGATAGCTAG
if my blog gets deleted you can find me in
a cave located beside Pacifidlog Town in the Route 134 ocean current. Take note that you will have to stick towards the very bottom of the screen. It is in a space of calm water there with a dark spot to Dive. Go where the inscription is and press B; say yes and go to the end. Use Dig go to the end of that tunnel and read the inscription. Put Relicanth last in your party and Wailord first, then go back and read the inscription again and there will be an earthquake. If this doesn’t work go and switch Relicanth to first and Wailord to last and there should be an earthquake. Then a box tells you it sounds like doors opening far away.
if my blog gets deleted, find me on the island on Route 130 when the last two bytes of the personality value of one of your party members matches matches a random value shuffled daily between 0x0000 and 0xFFFF
find me on select water tiles on route 119, but be careful of altering random values between attempts lest I change position
You can find me by holding the DS upside down while I level up
I do not own these pics. They were sent to me in an email. But I thought I’d share with you all because they’re just AMAZING.
DRAGONS
I feel so stupid I didn’t know they could fly, I thought they were like CHICKENS, I never questioned it because these pictures never circulate, I am WAY OVER MY HEAD.
My mom is a serious birder. One time she saw a peacock flying, and she swore that it was a phoenix
you know, seeing a peacock in flight makes me think that maybe the original depictins of angels where they have many wings, many eyes and are on fire were actually just peacocks all along
I am Silver Tongue, I am an artist. I have many characters and you can check out my art in the art tag. I occasionally practice witchcraft though I don't do anything too complicated. I am girl 2 and don't know what else to put here.
