softlyfiercely:

daggers-drawn:

stealthrockdamage:

people slipping up and saying shit like “biological name” instead of “deadname” is more or less proof these people don’t actually care about real science they just want smart sounding words and i guarantee if we could manipulate chromosomes they’d abandon all pretext of science and start yammering about how people are born with a “masculine/feminine essence” that “cant be changed” like none of these people actually know the chromosomes real fuckin function and they dont care they just know they cant be changed

“Biological name”

Scientists scanned my dna, I’m genetically a Sally but I chose my own fate.

i changed my name for non gender related reasons and people like to ask me “what’s your birth name” and i say “oh i actually wasn’t born with a name my parents just gave me one” and that tends to shut people up

My biological name? Oh it’s GATTCTCAGCGCGATCGTAGCTAGCGCGCTATCGATCGATAGCTAG

  1. fanofthestuff reblogged this from liska-rose
  2. lumiirac reblogged this from serensurana
  3. illpunchababy reblogged this from dewdrop828
  4. fairlyqueerdeer reblogged this from quarternotewhistle
  5. quarternotewhistle reblogged this from for-the-love-of-lucy
  6. for-the-love-of-lucy reblogged this from freakierthanthou
  7. cardablarrr reblogged this from writereadride
  8. writereadride reblogged this from reinelefey
  9. give-meg-a-flamethrower reblogged this from neon-genesis-evangaylion
  10. mer-squatch reblogged this from i-am-your-black-widow
  11. i-am-your-black-widow reblogged this from calamitycrowley
  12. calamitycrowley reblogged this from smileygirl08
  13. imgoingtogobacktheresomeday reblogged this from reinelefey
  14. smileygirl08 reblogged this from reinelefey
  15. reinelefey reblogged this from evaporites
  16. karikumik reblogged this from muinz
  17. regularwillow reblogged this from loremipsumflotsamandjetsam
  18. callmetoaster reblogged this from emberkyrlee
  19. watashihen reblogged this from keeningthoughts
  20. r0tb0t reblogged this from naamahdarling
  21. thunderous-desperado reblogged this from somerandomtransboy
  22. ndragoon reblogged this from xanotos
  23. xanotos reblogged this from primarining
  24. pngin-lvr reblogged this from elidyce
  25. luminousforest reblogged this from chatnip
  26. monsterhase reblogged this from injuries-in-dust
  27. booksmakeme reblogged this from simplydalektable
  28. spookyanxietygirl reblogged this from vampishly
  29. stealthrockdamage posted this