Silver Tongue

softlyfiercely:

daggers-drawn:

stealthrockdamage:

people slipping up and saying shit like “biological name” instead of “deadname” is more or less proof these people don’t actually care about real science they just want smart sounding words and i guarantee if we could manipulate chromosomes they’d abandon all pretext of science and start yammering about how people are born with a “masculine/feminine essence” that “cant be changed” like none of these people actually know the chromosomes real fuckin function and they dont care they just know they cant be changed

“Biological name”

Scientists scanned my dna, I’m genetically a Sally but I chose my own fate.

i changed my name for non gender related reasons and people like to ask me “what’s your birth name” and i say “oh i actually wasn’t born with a name my parents just gave me one” and that tends to shut people up

My biological name? Oh it’s GATTCTCAGCGCGATCGTAGCTAGCGCGCTATCGATCGATAGCTAG

  1. navianc reblogged this from astralwashboard
  2. astralwashboard reblogged this from honeylemony
  3. songsofloke reblogged this from localtransdude
  4. solovelinessreigned reblogged this from softlyfiercely
  5. boredom00111000 reblogged this from adrawrable
  6. ghostcats reblogged this from akirameta84
  7. destroyingminicakes reblogged this from chaoticrystal
  8. chaoticrystal reblogged this from akirameta84
  9. plaid-maniac reblogged this from akirameta84
  10. dontquestionthelemon reblogged this from danatooine
  11. danatooine reblogged this from galacticdemigod
  12. ren-stag reblogged this from akirameta84
  13. galacticdemigod reblogged this from akirameta84
  14. bluebottlemanofwarjellyfish reblogged this from akirameta84
  15. akirameta84 reblogged this from thetruthof
  16. thetruthof reblogged this from pinnaplecat
  17. nietseulb reblogged this from cosmic-pindrops
  18. ren-a-ren reblogged this from justaregulardecoratedemergency
  19. stealthrockdamage posted this