people slipping up and saying shit like “biological name” instead of “deadname” is more or less proof these people don’t actually care about real science they just want smart sounding words and i guarantee if we could manipulate chromosomes they’d abandon all pretext of science and start yammering about how people are born with a “masculine/feminine essence” that “cant be changed” like none of these people actually know the chromosomes real fuckin function and they dont care they just know they cant be changed
“Biological name”
Scientists scanned my dna, I’m genetically a Sally but I chose my own fate.
i changed my name for non gender related reasons and people like to ask me “what’s your birth name” and i say “oh i actually wasn’t born with a name my parents just gave me one” and that tends to shut people up
My biological name? Oh it’s GATTCTCAGCGCGATCGTAGCTAGCGCGCTATCGATCGATAGCTAG
aki13th liked this
navianc reblogged this from astralwashboard astralwashboard reblogged this from honeylemony
g-dblessed liked this
foreverapprentice liked this
songsofloke reblogged this from localtransdude
songsofloke liked this solovelinessreigned reblogged this from softlyfiercely
copperandstone liked this
dinosaursmate-x liked this
blackheartsofchrome liked this
vneshnee liked this
boredom00111000 reblogged this from adrawrable thatshroomintheforest liked this
candygoro liked this
aidendh liked this
ghostcats reblogged this from akirameta84
ghostcats liked this
malloen8c liked this
suhnnyskiess liked this q-v-butts liked this
chaoticrystal reblogged this from akirameta84
chaoticrystal liked this skitterstan liked this
plaid-maniac reblogged this from akirameta84
dontquestionthelemon reblogged this from danatooine
dead-in-a-ditch liked this
gfcasserole liked this
fishytimetraveler liked this danatooine reblogged this from galacticdemigod
ren-stag reblogged this from akirameta84
ren-stag liked this
galacticdemigod reblogged this from akirameta84
tansi-berrie liked this nothingsaa liked this
bluebottlemanofwarjellyfish reblogged this from akirameta84
anunreliablewriter liked this
thetruthof reblogged this from pinnaplecat
notosct liked this nietseulb reblogged this from cosmic-pindrops
loraluna liked this
ren-a-ren reblogged this from justaregulardecoratedemergency
stealthrockdamage posted this
- Show more notes