people slipping up and saying shit like “biological name” instead of “deadname” is more or less proof these people don’t actually care about real science they just want smart sounding words and i guarantee if we could manipulate chromosomes they’d abandon all pretext of science and start yammering about how people are born with a “masculine/feminine essence” that “cant be changed” like none of these people actually know the chromosomes real fuckin function and they dont care they just know they cant be changed
“Biological name”
Scientists scanned my dna, I’m genetically a Sally but I chose my own fate.
i changed my name for non gender related reasons and people like to ask me “what’s your birth name” and i say “oh i actually wasn’t born with a name my parents just gave me one” and that tends to shut people up
My biological name? Oh it’s GATTCTCAGCGCGATCGTAGCTAGCGCGCTATCGATCGATAGCTAG
fanofthestuff reblogged this from liska-rose
futuristicwormsociety liked this
taciturnsamurai liked this visanimus liked this
lumiirac reblogged this from serensurana ancmali liked this
illpunchababy reblogged this from dewdrop828
fairlyqueerdeer reblogged this from quarternotewhistle
quarternotewhistle reblogged this from for-the-love-of-lucy for-the-love-of-lucy reblogged this from freakierthanthou
cardablarrr reblogged this from writereadride
cardablarrr liked this hhow-queer liked this
writereadride reblogged this from reinelefey
give-meg-a-flamethrower reblogged this from neon-genesis-evangaylion
give-meg-a-flamethrower liked this
ventureisoutthere liked this
mer-squatch reblogged this from i-am-your-black-widow
mer-squatch liked this
spiderboiii liked this i-am-your-black-widow reblogged this from calamitycrowley
i-am-your-black-widow liked this
calamitycrowley reblogged this from smileygirl08 imgoingtogobacktheresomeday reblogged this from reinelefey
aiyawwei liked this
smileygirl08 reblogged this from reinelefey
smileygirl08 liked this reinelefey reblogged this from evaporites
karikumik reblogged this from muinz regularwillow reblogged this from loremipsumflotsamandjetsam
self-sailing-ships liked this
callmetoaster reblogged this from emberkyrlee
watashihen reblogged this from keeningthoughts hkxxzw liked this
r0tb0t reblogged this from naamahdarling
hannigramislife liked this
thunderous-desperado reblogged this from somerandomtransboy ndragoon reblogged this from xanotos
xanotos reblogged this from primarining
pngin-lvr reblogged this from elidyce
pngin-lvr liked this
luminousforest reblogged this from chatnip
monsterhase reblogged this from injuries-in-dust
booksmakeme reblogged this from simplydalektable
spookyanxietygirl reblogged this from vampishly
spookyanxietygirl liked this soraekii liked this
thegostofjon liked this
stealthrockdamage posted this
- Show more notes