people slipping up and saying shit like “biological name” instead of “deadname” is more or less proof these people don’t actually care about real science they just want smart sounding words and i guarantee if we could manipulate chromosomes they’d abandon all pretext of science and start yammering about how people are born with a “masculine/feminine essence” that “cant be changed” like none of these people actually know the chromosomes real fuckin function and they dont care they just know they cant be changed
“Biological name”
Scientists scanned my dna, I’m genetically a Sally but I chose my own fate.
i changed my name for non gender related reasons and people like to ask me “what’s your birth name” and i say “oh i actually wasn’t born with a name my parents just gave me one” and that tends to shut people up
My biological name? Oh it’s GATTCTCAGCGCGATCGTAGCTAGCGCGCTATCGATCGATAGCTAG