Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is “too short” and “doesn’t match any known organism” and if my genome looked like that i would be “dead” but maybe those people simply haven’t optimized their genomes like I have
skyediamonia reblogged this from somethingintheforest - skyediamonia liked this
lionloyal reblogged this from firstginger
yourcloudlessrain liked this 
apologizingtoaveryneedycat liked this julia-nurit liked this
angearth liked this camdenstarr reblogged this from possum-with-a-banjo
sarinaapril14 liked this mosleymoe liked this
teaandstudytime liked this 
thenorsiest liked this bluemonkeydevil liked this
otakulture-art liked this
enfysalina reblogged this from citizenjolras
supercomplicatedperson reblogged this from starkillersbae - supercomplicatedperson liked this
starkillersbae reblogged this from firstginger
melody-pines liked this
pomilomi reblogged this from pastelbluberri
owl-knight liked this
thegoodsandy reblogged this from toastpotent
smolandevil liked this
absolutedad reblogged this from soft-girl-anxiety
widocats liked this
tarotandtea-leaves reblogged this from kaijuno 
soft-girl-anxiety reblogged this from sapphire-knight crackmonkeytrash liked this
anguilliforme reblogged this from ladymoonjelly
graciemakesanentrance liked this
4hoots liked this - 4hoots reblogged this from kkamikazed
ciipherstatic liked this pinkyshy101 liked this
bardocklives liked this
the-mind-races reblogged this from firstginger 
andthentheirwerenone reblogged this from bandtrees jeremythemoth liked this
goyaconnect liked this
cielamakara liked this
clarisselaruee liked this silent-winged liked this
cabbatoge reblogged this from pomel00
speckledbears liked this 
bandtrees reblogged this from kkamikazed 
background-vulcan liked this 
chokers-and-bad-attitudes reblogged this from screaming-nope papasmoke posted this
Please list your full genome sequence in your bio
- Show more notes
