Silver Tongue

papasmoke:

papasmoke:

papasmoke:

Please list your full genome sequence in your bio

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

People are telling me that this genome sequence is “too short” and “doesn’t match any known organism” and if my genome looked like that i would be “dead” but maybe those people simply haven’t optimized their genomes like I have

Reblogged 2 years ago from rockboci (Originally from papasmoke)
53,643 notes
  1. arthentine reblogged this from ladykailolu
  2. ladykailolu reblogged this from insemzandtaya
  3. insemzandtaya reblogged this from watcherscrown
  4. boatgameenjoyer reblogged this from its-a-trapta
  5. 3collecurei reblogged this from papasmoke
  6. idiotvera reblogged this from lordbubblebot
  7. the2amrevolution reblogged this from wickedwitch-of-the-left
  8. pterodactyal reblogged this from ouranwannabe
  9. whatanightmareeeeee reblogged this from wickedwitch-of-the-left
  10. lesbeansprout reblogged this from generic-internet-name
  11. brain-empty-no-thoughts reblogged this from allafey
  12. allafey reblogged this from pastelmogar
  13. thursdaynights reblogged this from alienalijah
  14. liviamall reblogged this from rogueofstars
  15. artemiswanderer reblogged this from gender-communist
  16. paruparfait reblogged this from lesbian-roguefort
  17. gender-communist reblogged this from monsterlets
  18. gomezaddamsofficial reblogged this from bantambookeater
  19. caelumcorvidae reblogged this from designerbodybag
  20. papasmoke posted this